Screening for COVID-19 (til diagnostikk)

Screening for COVID-19 (til diagnostikk)

PRIMERE & PROBER FOR E-GEN ANALYSE VED qPCR

BioNordika har per 19.03.2020 en lagerbeholdning på 86 kit (1000 reaksjoner per kit) av primere og prober spesifikk for deteksjon av Sarbeco betakoronavirus (E-gen analyse) ved in-house qPCR. Primer- og probesekvensen er oppgitt nedenfor.

Det er ønskelig at denne lagerbeholdningen i størst mulig grad bevares til kritiske situasjoner ved laboratoriene. Derfor oppfordrer vi de som har et normalt behov benytter «Alternativ 1» oppgitt under ved bestilling.


Dersom antall prøver per dag overstiger 300 ved et laboratorium, ber vi om at vi får beskjed om dette så raskt som mulig, slik at vi kan utvide vårt kriselager.

ALTERNATIV 1: Produksjon på bestilling

 Bestilling foregår ved å fylle inn ønsket mengde og leveringsadresse i dette bestillingsskjemaet. Sekvenser for E-gen (se tabell nedenfor) er allerede lagt inn i skjemaet. Velg synteseskala i henhold til behov. Vår leverandør, Eurogentec, produserer nå primere og prober kontinuerlig og produktet sendes normalt innen få dager. Leveranser vil da gå direkte fra Eurogentec til kunde. Disse primerne og probene leveres som tørrstoff.

Scale Primer (#tubes of 10 nmol) Probe(#tubes of 10 nmol)
40 nmol 2 1
200 nmol 5 2
1000 nmol 10 3
2500 nmol 25 7


Skjema sendes kun til info@bionordika.no. Ved spørsmål om utfylling kan du kontakte gitika@bionordika.no eller herman@bionordika.no

ALTERNATIV 2: Bestilling fra kriselager ved kritiske situasjoner

Benytt produktnummer CS-ALIQ-SA20005-Egene
Pris: 5000,- ekskl. mva. per kit (1000 reaksjoner)

Prisene er oppgitt eks. mva og frakt. 

E-gene primers og probes specification: the probe concentration has been adapted to 50µM concentration where the primers are at 100µM in MB water.   

E-gene-F sequence: ACAGGTACGTTAATAGTTAATAGCGT
E-gene-R sequence: ATATTGCAGCAGTACGCACACA
E-gene-P sequence: FAM ACACTAGCCATCCTTACTGCGCTTCG BHQ1

Bestillingen må inneholde produktnummer, antall kit, leveringsadresse, fakturaadresse og en eventuell fakturareferanse.
Bestilling sendes til info@bionordika.no og kopi til gitika@bionordika.no

Produktet kan leveres med ekspresslevering mot ekstra fraktkostkostnader.

 

MAGNAPURE 96 BARKODEDE CARTRIDGES

Det er flere produkter som er mangelvare som en konsekvens av den pågående COVID-19 pandemien. Vår samarbeidspartner BIOplastics leverer plater, strips og lokk til qPCR/PCR maskiner. I tillegg har de nå satt i gang produksjon av støpeform til MagnaPure 96. Dersom alt går etter planen, mener de å ha varer klare til slutten av april.

BIOplastics har produksjon i Nederland og de har alle råvarer tilgjengelig. Ta kontakt om du vil sette deg på liste for oppdatering.

 

QPCR REAGENSER

Takyon One Step Probe Mastermiks
Dette kittet er i bruk ved en rutinelab i Sveits som detekterer corona-virus.
Ta gjerne kontakt for å sjekke lagerstatus og protokoll.

LunaScript RT Supermix Kit (#E3010)
• Syntetiser cDNA på mindre enn 15 minutter! 
• Et enkeltrør med Supermix inneholder hexamerer, oligo-dT primere, dNTPs, Murine RNase inhibitor, og Luna revers transcriptase
• Tracking dye hjelper med å visualisere og minimere pipetteringsfeil
• Kombiner med Luna qPCR mastermix for et robust RT-qPCR resultat
Les mer her

Luna Onestep probe RT-qPCR Kit, #E3006S/L/X/E
• Rask, sensitive og presis probe-basert qPCR deteksjon og kvantifisering av “target”-RNA
• Alle Luna produktene har undergått nøye testing for å optimalisere spesifisiteten, sensitiviteten, nøyaktigheten og reproduserbarheten til produktene
• Luna gir overlegne resultater I forhold til andre kommersielt tilgjengelige qPCR og RT-qPCR reagenser på markedet
Les mer her

 

Virusdeteksjon (SARS-CoV-2 / COVID-19) i felt - uten kostbare analyseinstrumenter!

BioNordika kan i samarbeid med New England Biolabs (NEB) tilby et Colorimetric LAMP kit som er designet for å gi en enkel one-step løsning på visuell deteksjon av positiv eller negativ virustest i felt uten kompleks diagnostisk infrastruktur.

Metoden muliggjør en robust og enkel testing uten dyre instrumenter, og kan utføres i felt. Positivt eller negativt resultat indikeres av et fargeskift hvor negative reaksjoner er rosa mens de positive blir gule. Systemet er designet for gi en rask, visuell deteksjon av amplifisering i prøven basert på produksjon av protoner og et påfølgende dropp i pH som skjer som en følge av DNA polymeraseaktivitet i en LAMP reaksjon, noe som igjen gir et fargeskift i pH-indikatoren i løsningen.

Lær mer om hvordan Colorimetric LAMP ble brukt til rask deteksjon av coronavirus (SARS-CoV-2, covid-19) RNA i denne publikasjonen.

M1800S: WarmStart Colorimetric LAMP 2X Master Mix (DNA & RNA) - 100 rxns
M1800L: WarmStart Colorimetric LAMP 2X Master Mix (DNA & RNA) - 500 rxns