Screening for COVID-19 (til diagnostikk)

Screening for COVID-19 (til diagnostikk)
Oppdatert informasjon 25.05.2021.
 

Vi tilbyr flere produkter som er essensielle for deteksjon av SARS-CoV-2.


Våre samarbeidspartnere i Caliber Scientific tilbyr virus transportmedium, og vi kan levere MagNA Pure kompatible cartridge og output plater fra BIOplastics, og lysisbuffer til MagNA Pure 96 fra Caliber. Produksjonen av SARS-CoV-2 primere og prober går kontinuerlig hos Eurogentec, og de har økt lagerbeholdningen av One Step qPCR probe reagenser. I tillegg har vi CE-merkede multiplekspanel som detekterer SARS-CoV-2 (ORF1 og ORF8), influensa og RSV fra AusDiagnostics, samt CE-IVD ELISA kit.

Denne siden vil oppdateres jevnlig. Ta kontakt med Gitika dersom du har spørsmål.

SARS-CoV-2 kontroller

Vi tilbyr kvalitetskontroller for SARS Cov2 til molekylærdiagnostikk og serologi fra Twist og Randox.

TWIST SARS-CoV-2 RNA kontroller

Vi kan levere positive RNA kontroller for flere varianter av SARS-CoV-2. Disse kan brukes til både NGS og RT-qPCR.

Les mer her.

Kat. nr. Kontroll Genbank ID Gisaid navn
102019 Control 1 MT007544.1 Australia/VIC01/2020
102024 Control 2 MN908947.3 Wuhan-Hu-1
103925 Assay Ready Control 2 MN908947.3 Wuhan-Hu-1
102860 Control 3 LC528232.1 Japan/Hu_DP_Kng_19-020/2020
102862 Control 4 MT106054.1 USA/TX1/2020
102917 Control 5 MT188340 USA/MN2-MDH2/2020
102918 Control 6 MT118835 USA/CA9/2020
103087 Control 7 EPI_ISL_418227 France/HF2393/2020
103511 Control 8 MT066176 Taiwan/NTU02/2020
103512 Control 9 MT152824 USA/WA2/2020
103513 Control 10 EPI_ISL_414648 USA/CA-PC101P/2020
103514 Control 11 EPI_ISL_417739 Iceland/5/2020
103515 Control 12 EPI_ISL_420244 England/SHEF-C05B2/2020
103533 Control 13 EPI_ISL_421184 Belgium/ULG-10004/2020
103907 Control 14 EPI_ISL_710528 England/205041766/2020
103926 Assay Ready Control 14
(B.1.1.7)
EPI_ISL_710528 England/205041766/2020
103909 Control 15 EPI_ISL_601443 England/MILK-9E05B3/2020
103927 Assay Ready Control 15 (B.1.1.7) EPI_ISL_601443 England/MILK-9E05B3/2020
104043 Control 16 (B.1.351) EPI_ISL_678597 South Africa/KRISP-EC-K005299/2020
104044 Control 17 (P.1) EPI_ISL_792683 Japan (Brazil) /IC-0564/2021
104338 Control 18 (B.1.617.1) EPI_ISL_1662307 India/CT-ILSGS00361/2021
104533 Control 23
Delta (B.1.617.2)
EPI_ISL_1544014 India/MH-NCCS-P1162000182735/2021
104534 Control 24 (B.1.617.3) EPI_ISL_1939891 India/MH-SEQ-221_S66_R1_001/2021
Randox Anti SARS-CoV-2 kontroller til serologi
  • Liquid Ready To Use
  • Lagres på 2°C - 8°C
  • 30 dager stabilitet
COV10460 Anti SARS-CoV-2 Controls, 2 x 2 x 4 ml Les mer
EQA til SARS-CoV-2 – Antigen testing pilot

Randox  QCMD EQA pilotstudie for SARS-CoV-2 (COVID-19) Antigen Testing. Denne piloten er designet for å evaluere laboratoriets evne til å detektere SARS-CoV-2 (COVID-19) antigen og gir mulighet til å vurdere ytelsen mot en internasjonal peer group

Les mer her

SARS-CoV-2 kontroller til molekylærdiagnostikk

SARS-CoV-2 Rapid Colorimetric LAMP Assay Kit

SARS-CoV-2 Rapid Colorimetric LAMP Assay Kit bruker isotermisk amplifikasjon i analysen av SARS-CoV-2, det nye coronaviruset som forårsaker COVID-19.

  • Kolorimetrisk LAMP muliggjør enkel, visuell påvisning (rosa til gul) av amplifikasjon av SARS-CoV-2 nukleinsyre
  • Sett opp reaksjoner raskt og enkelt ved hjelp av en enkel varmekilde og unik WarmStart®-teknologi
  • Reduser risikoen for overføring av forurensning, med UDG og dUTP inkludert i masterblandingen
  • Analysen retter seg mot N- og E-regionene i SARS-CoV-2-genomet for optimal følsomhet og spesifisitet
E2019S   SARS-CoV-2 Rapid kolorimetrisk LAMP analysesett
96 reaksjoner
Protokoll

Dette produktet er ikke CE-IVD merket.

Priser og bestilling

Listepriser er tilgjengelige i vår webshop. Du kan også kontakte oss for prisinformasjon eller bestilling via e-post.

SARS-CoV-2 Rapid Colorimetric LAMP Assay Kit

Luna® SARS-CoV-2 RT-qPCR Multiplex assay kit

Luna SARS-CoV-2 RT-qPCR Multiplex assay kittet fra New England BioLabs (NEB) er et «real-time» RT-PCR assay for kvalitativ deteksjon av SARS-CoV-2 nukleinsyrer. Kittet kan også brukes til deteksjon av muterte virusvarianter, slik som variantene B117 og B1351 oppdaget i henholdsvis Storbritannia og Sør-Afrika, men kittet skiller ikke mellom disse variantene og kan derfor ikke brukes til å påvise en bestemt variant.

Høydepunkter:

  • Multiplex deteksjon av 2019-nCoV-N1 og 2019-nCoV-N2 mål og humane RNase P gener
  • Støtter sammenslåing av prøver uten å miste sensitivitet
  • Øk assay sensitivitet gjennom en 4X RT-qPCR mix og bruk mer prøvemateriale
  • Reduser risiko for kontaminering med termolabil UDB og dUTP inkludert i master mix

Luna SARS-CoV-2 RT-qPCR Multiplex Assay Kit innhold:

  • Luna® Probe One-Step RT-qPCR 4X Mix med UDG
  • SARS-CoV-2 positiv kontroll (N gene)
  • SARS-CoV-2 Primer/Probe Mix (N1/N2/RP)
  • Nuklease-fritt vann

Les mer her. 

E3019S Luna® SARS-CoV-2 RT-qPCR Multiplex assay kit  96 reactions Protokoll
E3019L Luna® SARS-CoV-2 RT-qPCR Multiplex assay kit  480 reactions Protokoll

Kittet er ikke CE-IVD merket. 

Priser og bestilling

Listepriser er tilgjengelige i vår webshop. Du kan også kontakte oss for prisinformasjon eller bestilling via e-post.

MagNA Pure 96 forbruksvarer

Forbruksvarer til MagNA Pure er mangelvare i disse dager, og vår samarbeidspartner, BIOplastics, har laget en ny støpeform for plater til Magna Pure 96. Prosessplatene har blitt utviklet i nært samarbeid med myndighetene i Nederland. 

Platene er verifisert på MagNA Pure System av ISO15189 akkrediterte medisinske mikrobiologiske laboratorier i Nederland. 

Tilbakemeldingen fra avdeling for mikrobiologi ved et norsk sykehus er at platene er noe trangere å få ned i reagensboksen, men ellers fungerer de fint.

Caliber Scientific leverer også MagNA Pure kompatibel lysisbuffer.

Deep Well 96 Process Plate
Produktnummer: BN-C17480
Beskrivelse: Deep Well 96 Process Plate Roche Compatible to Mag-NA Pure 96 Processing Cartridge Deep well plates with 96 cavities Barcoded
Forpakning: 30 stk. pr. eske

96 DNA /RNA Clean output Plate
Produktnummer: BN-D17480
Beskrivelse: 96 DNA/RNA Clean output Plate Roche Compatible to Mag-NA Pure 96 output plates with 96 cavities, V bottom and barcoded
Forpakning: 25 stk. pr. eske

MagBead Viral RNA Lysis Buffer
• Validert og i bruk ved Ireland’s Health Service Executive, HSE 
• Direkte erstatning for Roche MagNA Pure 96 External Lysis Buffer (Code: 06374913001), Biomérieux Nuclisens Lysis Buffer (Code: 280134) og Qiagen Buffer RNAeasy Lysis Buffer (Code: 79216)
• Gratis validering til alle laber
• 500 ml og 10 L forpakninger
• Produsert i UK

Produktnummer: BSV-COV-001 / BSV-COV-002  
Beskrivelse: MagBead Viral RNA Lysis Buffer 500 ml / 10 L
Forpakning: 2 x 250 ml / 40 x 250 ml
Pakkevedlegg

MagNA PURE er et registrert varemerke for Roche. 
MagNA Pure 96 forbruksvarer
MagNA Pure 96 forbruksvarer

CE-IVD Multiplekspanel SARS-CoV-2

AusDiagnostics leverer CE-IVD merket panel for deteksjon av SARS-CoV-2. Flere hundre tusen tester har blitt levert ut til sykeshuslaboratorier.
Les instruksjonene her.

Influensa A: Panelet detekterer influensa A og inkluderer H1, H3, H5 og H7
Typing: Serotypene pdH1N1 og H3 (inkludert H3N2) blir differensiert
Influensa B: (Yamagata og Victoria lineages)
RSV: Inkluderer og skiller mellom type A og B
SARS-CoV-2a: ORF 1 genet
SARS-CoV-2b: ORF 8 genet
Sample Adequacy: Humant referansegen for sample adequacy control
SPIKE: Sequence for kontoll av assay

For informasjon om andre panel se her.

Dersom det er ønskelig med en uttesting, vil det være mulig å låne et demoinstrument på sikt.
Ta kontakt dersom du ønsker å sette deg på liste for informasjon.

Artikkel i Diagnostics World: 
AusDiagnostics dual target SARS-CoV-2, Influenza and RSV panel achieved 100% sensitivity and 100% specificity in a study of 210 samples (44 from COVID-19 patients). The work was done by scientists at Westmead Hospital and presented to the TGA.
Les den her. 

Les mer om AusDiagnostics og deres forskjellige CE-IVD multipleks paneler

Primere og prober for E-gen analyse

Bestilling foregår ved å fylle inn ønsket mengde og leveringsadresse i dette bestillingsskjemaet. Sekvenser for E-gen er allerede lagt inn i skjemaet. Velg synteseskala i henhold til behov. Vår leverandør, Eurogentec, produserer nå primere og prober kontinuerlig og produktet sendes normalt innen få dager. Leveranser vil da gå direkte fra Eurogentec til kunde. Disse primerne og probene leveres som tørrstoff.

E-gene-F sequence: ACAGGTACGTTAATAGTTAATAGCGT
E-gene-R sequence: ATATTGCAGCAGTACGCACACA
E-gene-P sequence: FAM ACACTAGCCATCCTTACTGCGCTTCG BHQ1

Scale Primer (#tubes of 10 nmol) Probe(#tubes of 10 nmol)
40 nmol 2 1
200 nmol 5 2
1000 nmol 10 3
2500 nmol 25 7

Høyere synteseskala primere og prober koster mindre
Jo høyere skala man bestiller jo billigere blir produksjonen. Eurogentec har oppskalert produksjonen av oligoer til oligoene som er publisert i WHO protokollen for deteksjon av SARS CoV-2.  

Det er nå mulig å bestille høyere skala med følgende mengder per primere og prober:
Du kan selvfølgelig velge ulik skala for primere og prober. Merk! Disse oligoene blir ikke alikvotert i rør med 10 nmol/rør.

5000 nmol scale:
Primer 500 nmol
Probe 140 nmol
Totalpris E-gen primere og prober: 31 939,- eks. mva.

10000 nmol scale:
Primer 1000 nmol
Probe 290 nmol
Totalpris E-gen primere og prober: 50 080,- eks. mva.

20000 nmol scale:
Primer 2100 nmol
Probe 600 nmol
Totalpris E-gen primere og prober: 74 678,- eks. mva.

Skjema sendes til info@bionordika.no
Ved spørsmål om utfylling kan du kontakte Gitika eller Herman

qPCR plater og seals

BIOplastics designer og produserer produkter fra polymer plast som brukes i molekylærdiagnostikk. Plater, strips, seals, rør leveres til en rekke produsenter av diagnostiske kit. De tilbyr derfor plast til svært mange ulike typer qPCR/PCR instrumenter med og uten barkoder. I tillegg har de en god lagerbeholdning som økes raskt etter behov.

Les mer her

Her er noen eksempler på de mest vanlige produktene. Men spør oss gjerne om du trenger noe annet – det er ganske sannsynlig at de har det du trenger.

Type of instrument LightCycler 480 ABI maskiner med standard blokk ABI maskiner med fast blokk BioRad CFX ARIAMX Pipetteringsroboter
Plater #B17489 #AB17500 #AB19800 #B70671 #B60101-1 #B70671
Plater med barkoder #BB17489L BB17500L #AB19800LB - #BB17489L  
Seals Opti-Seal (#157300) Opti-Seal (#157300)​​​​​ Opti-Seal (#157300)​​​​​ Opti-Seal (#157300)​​​​​ Opti-Seal (#157300)  
Strips EU 8-tube strip,SFGC (#BB77009) EU 8-tube strip,SFGC (#B77101) EU 8-tube strip,SFGC (#B77001) EU 8-tube strip,SFGC (#B77009) EU 8-tube strip,SFGC (#B77001)  
Lokk

EU Optical robust flat 8-Cap Strip (#B79701-1) 

Reusable Adaptor (#B17489X)

EU Optical robust flat 8-Cap Strip (#B79701-1) EU Optical robust flat 8-Cap Strip (#B79701-1) EU Optical robust flat 8-Cap Strip (#B79701-1) EU Optical robust flat 8-Cap Strip (#B79701-1) EU Optical robust flat 8-Cap Strip (#B79701-1)

qPCR reagenser

Takyon One Step Probe Mastermiks (rox, low rox og no rox)

Eurogentec har økt produksjonen sin kraftig og hadde før påske kit til å kjøre over 1 000 000 qPCR reaksjoner. Både high, low og no rox variantene kan brukes til å detektere SARS CoV-2.

Protokoll
Last ned brosjyre

Ta gjerne kontakt for nærmere informasjon

Luna Onestep probe RT-qPCR Kit, #E3006S/L/X/E

• Rask, sensitive og presis probe-basert qPCR deteksjon og kvantifisering av “target”-RNA
• Alle Luna produktene har undergått nøye testing for å optimalisere spesifisiteten, sensitiviteten, nøyaktigheten og reproduserbarheten til produktene
Les mer her

CE-IVD COVID-19 IgG / IgM ELISA KIT

Vår samarbeidspartner, BioServUK kan tilby CE-IVD sertifiserte ELISA kit for deteksjon av IgG og IgM SARS-CoV-2 antistoffer i serum og plasma.  Coronavirus COVID-19 IgG/IgM ELISA kit.

Det tilbys tre ulike CE-IVD kit for deteksjon av antistoffer mot SARS-CoV-2:
BSV-3920: GA CoV-2 IgG EIA, 96 tester 
BSV-3930: GA CoV-2 IgM EIA, 96 tester
BSV-3940: GA CoV-2 IgG+ EIA, 96 tester

Les mer om kittene her

CE-IVD COVID-19 IgG / IgM ELISA KIT

Vi anbefaler i utgangspunktet bruk av alle tre kitene i en screening for antistoffer mot SARS-CoV-2. Deteksjon av IgM-antistoffer kan si noe om den tidlige immunresponsen, mens deteksjon av IgG-antistoffer kan si noe om den langvarige immunresponsen. IgG+ kittet kan benyttes for videre differensiering av antistoffer mot SARS CoV-2 N-, S1- and S2- proteiner.

• ELISA screening for deteksjon av IgG eller IgM SARS CoV-2 antistoffer
• Mulighet til å differensiere andre coronavirusinfeksjoner og evaluering av immunrespons
• CE-IVD sertifisert
• 96 tester per kit, inkludert positive og negative kontroller
• Full automatisering mulig

I tillegg har de RuO kit av følgende:
SARS-CoV-2 (2019-nCoV) Nucleoprotein / NP ELISA Kit (kat. nr. BSV-ELISA-01) 
SARS-CoV-2 (2019-nCoV) Spike ELISA Kit (96 tests) (kat. nr. BSV-ELISA-03)

Ta kontakt dersom dette er av interesse

Virusdeteksjon (SARS-CoV-2 / COVID-19) i felt

BioNordika kan i samarbeid med New England Biolabs (NEB) tilby et Colorimetric LAMP kit som er designet for å gi en enkel one-step løsning på visuell deteksjon av positiv eller negativ virustest i felt uten kompleks diagnostisk infrastruktur.

Metoden muliggjør en robust og enkel testing uten dyre instrumenter, og kan utføres i felt. Positivt eller negativt resultat indikeres av et fargeskift hvor negative reaksjoner er rosa mens de positive blir gule. Systemet er designet for gi en rask, visuell deteksjon av amplifisering i prøven basert på produksjon av protoner og et påfølgende dropp i pH som skjer som en følge av DNA polymeraseaktivitet i en LAMP reaksjon, noe som igjen gir et fargeskift i pH-indikatoren i løsningen.

Lær mer om hvordan Colorimetric LAMP ble brukt til rask deteksjon av coronavirus (SARS-CoV-2, covid-19) RNA i denne publikasjonen.

M1800S: WarmStart Colorimetric LAMP 2X Master Mix (DNA & RNA) - 100 rxns
M1800L: WarmStart Colorimetric LAMP 2X Master Mix (DNA & RNA) - 500 rxns